Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • br Deconstructing repression evolving models of co repressor

    2020-08-12


    Deconstructing repression: evolving models of co-repressor action. Nat.
    Rizzardi, A.E., Johnson, A.T., Vogel, R.I., Pambuccian, S.E., Henriksen, J., Skubitz, A.P., Metzger, G.J., and Schmechel, S.C. (2012). Quantitative com-parison of immunohistochemical staining measured by digital image analysis versus pathologist visual scoring. Diagn. Pathol. 7, 42.
    Tepaamorndech, S., Huang, L., and Kirschke, C.P. (2011). A null-mutation in the Znt7 gene accelerates prostate tumor formation in a transgenic adenocar-cinoma mouse prostate model. Cancer Lett. 308, 33–42.
    Welti, J., Rodrigues, D.N., Sharp, A., Sun, S., Lorente, D., Riisnaes, R., Figueiredo, I., Zafeiriou, Z., Rescigno, P., de Bono, J.S., et al. (2016). Analytical validation and clinical qualification of a new immunohistochemical assay for androgen receptor splice variant-7 protein n-Dodecyl-β-D-maltoside in metastatic castration-resistant prostate cancer. Eur. Urol. 70, 599–608.
    STAR+METHODS
    KEY RESOURCES TABLE
    REAGENT or RESOURCE SOURCE
    IDENTIFIER
    Antibodies
    Rabbit polyclonal anti-AR (N-20) Santa Cruz Biotechnologies
    Mouse monoclonal anti-AR (441) Santa-Cruz Biotechnologies
    Rabbit polyclonal anti-AR (PG21) Millipore
    Rabbit polyclonal C-terminal AR (Cone SP242) Spring Bioscience
    Rabbit polyclonal C-terminal AR (C-19) Santa Cruz Biotechnologies
    Rabbit monoclonal ARv7 (H6 253) Epitomics (now Abcam)
    Rabbit monoclonal anti-ARv7 (clone RM7) RevMab
    Rabbit polyclonal NCOR1 (PA1-844A) Thermo Fisher Scientific
    Rabbit polyclonal NCOR2 (ab24551) Abcam
    Rabbit polyclonal FOXA1 (ab23738) Abcam
    Goat polyclonal FOXA1 (ab5089) Abcam
    Mouse monoclonal b-Actin Abcam
    Rabbit monoclonal Lamin B1 (EPR8985) Abcam
    Monoclonal mouse anti-rabbit IgG, light chain specific Jackson ImmunoResearch
    FITC-conjugated swine anti-rabbit
    DAKO
    Biological Samples
    CRPC tumor metastases samples University of Washington and Fred
    Hutchinson Cancer Research Center
    Chemicals, Peptides, and Recombinant Proteins
    Sigma
    Critical Commercial Assays
    TruSeq stranded mRNA sample kit Illumina
    ThruPLEX DNA-seq kit
    Rubicon Genomics
    Deposited Data
    RNA-seq This paper
    ChIP-seq This paper
    CRPC tumor metastases samples Kumar et al., 2016
    Genome-wide expression profiling of radical Den et al., 2014
    prostatectomies
    Genome-wide expression profiling of radical Ross et al., 2016
    prostatectomies
    Genome-wide expression profiling of radical Benzon et al., 2017
    prostatectomies
    Genome-wide expression profiling of radical Karnes et al., 2013
    prostatectomies
    Genome-wide expression profiling of radical Erho et al., 2013
    prostatectomies
    Genome-wide expression profiling of radical Klein et al., 2015
    prostatectomies
    Genome-wide expression profiling of radical Boormans et al., 2013
    prostatectomies
    Genome-wide expression profiling of radical Taylor et al., 2010
    prostatectomies
    Taylor dataset
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    Experimental Models: Cell Lines
    Human: LNCaP95 shGFP This paper N/A
    Human: LNCaP95 shARfl This paper N/A
    Human: LNCaP95 shARv7 This paper N/A
    Human: 22Rv1 shGFP This paper N/A
    Human: 22Rv1 shARfl This paper N/A
    Human: 22Rv1 shARv7 This paper N/A
    Human: Hep3B
    ATCC
    Oligonucleotides
    shGFP-forward: This paper N/A
    5’-CCGGGCAAGCTGACCCTGAAGTTCACTCG
    AGTGAA CTTCAGGGTCAGCTTGCTTTTTG-3’
    shGFP-reverse: This paper N/A
    5’-AATTCAAAAAGCAAGCTGACCCTGAAGTT
    CACTCGAGTGAACTTCAGGGTCAGCTTGC-3’
    shARfl-forward: This paper N/A
    5’-CCGGCCTGCTAATCAAGTCACACATCTCG
    AGATGTGTGACTTGATTAGCAGGTTTTTG-3’
    shARfl-reverse: This paper N/A
    5’-AATTCAAAAACCTGCTAATCAAGTCACAC
    ATCTCGAGATGTGTGACTTGATTAGCAGG-3’
    shARv7-forward: 5’-CCGGGTAGTTGTGAGTA This paper N/A
    TCATGACTCGAGTCATGATACTCACAACTAC
    shARv7-reverse: 5’-AATTCAAAAAGTAGTTGTG This paper N/A
    AGTATCATGACTCGAGTCATGATACTCACA
    Primers for site-directed mutagenesis of pEYFP- This paper N/A
    CTATTGAT-3’
    Primers for site-directed mutagenesis of pEYFP- This paper N/A
    TCTGTTT-3’
    Recombinant DNA
    pECFP-(GA)6-ARv7 This paper N/A
    This paper
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE
    IDENTIFIER
    Software and Algorithms
    Aperio ImageScope Leica Biosystems
    Aperio Brightfield Image Analysis Toolbox Leica Biosystems
    https://bitbucket.org/cfce/viper/
    DEseq Anders and Huber, 2010